Transcript: Mouse XM_011245338.1

PREDICTED: Mus musculus alpha-methylacyl-CoA racemase (Amacr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Amacr (17117)
Length:
1234
CDS:
202..876

Additional Resources:

NCBI RefSeq record:
XM_011245338.1
NBCI Gene record:
Amacr (17117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328281 GATTTGGCCAATCGGGAATTT pLKO_005 24 5UTR 100% 13.200 18.480 N Amacr n/a
2 TRCN0000328282 TCTATGCACTGCTGCTTAAAG pLKO_005 446 CDS 100% 13.200 18.480 N Amacr n/a
3 TRCN0000189869 CAGATCTTTGACGGGACAGAT pLKO.1 580 CDS 100% 4.950 3.960 N Amacr n/a
4 TRCN0000328208 TGGTGAAGTGTATCCATTTAT pLKO_005 1126 3UTR 100% 15.000 10.500 N Amacr n/a
5 TRCN0000328209 TGGCCATGACATCAACTATTT pLKO_005 58 5UTR 100% 13.200 9.240 N Amacr n/a
6 TRCN0000353409 CAGAATGGTGCCAGATCTTTG pLKO_005 569 CDS 100% 10.800 7.560 N Amacr n/a
7 TRCN0000202284 GCTGGCCATGACATCAACTAT pLKO.1 56 5UTR 100% 5.625 3.938 N Amacr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.