Transcript: Mouse XM_011245344.2

PREDICTED: Mus musculus cadherin 12 (Cdh12), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh12 (215654)
Length:
15328
CDS:
1004..3388

Additional Resources:

NCBI RefSeq record:
XM_011245344.2
NBCI Gene record:
Cdh12 (215654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094534 CCAGTATTTCAATGCCTGTAA pLKO.1 6044 3UTR 100% 4.950 6.930 N Cdh12 n/a
2 TRCN0000055504 GCGCAGTATAATTTCTCCATA pLKO.1 2360 CDS 100% 4.950 6.930 N CDH12 n/a
3 TRCN0000094536 CGATCCCATTTCCAACGAGTT pLKO.1 1139 CDS 100% 4.050 5.670 N Cdh12 n/a
4 TRCN0000094535 GCAGCAATTCTCCTTTAGATT pLKO.1 2566 CDS 100% 5.625 3.938 N Cdh12 n/a
5 TRCN0000094537 GCAGAATCACTCAGCTCCATA pLKO.1 3245 CDS 100% 4.950 3.465 N Cdh12 n/a
6 TRCN0000094538 CAGGTGTCATTAGAACAGCAT pLKO.1 1647 CDS 100% 2.640 1.848 N Cdh12 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3469 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3459 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.