Transcript: Mouse XM_011245394.1

PREDICTED: Mus musculus Mdm2, transformed 3T3 cell double minute p53 binding protein (Mtbp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtbp (105837)
Length:
3381
CDS:
188..2092

Additional Resources:

NCBI RefSeq record:
XM_011245394.1
NBCI Gene record:
Mtbp (105837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248198 ACGAATGTTAGTGCGTATAAT pLKO_005 986 CDS 100% 15.000 21.000 N Mtbp n/a
2 TRCN0000248197 ATTTGACCGCAACCAATATTT pLKO_005 306 CDS 100% 15.000 21.000 N Mtbp n/a
3 TRCN0000178195 CCGTGTACTGTTAGCAATGTA pLKO.1 1238 CDS 100% 5.625 7.875 N Mtbp n/a
4 TRCN0000248194 ACGGTACAGTTGAACCTTATT pLKO_005 1782 CDS 100% 13.200 9.240 N Mtbp n/a
5 TRCN0000181600 GCGTGGTAAATGATGACGGTA pLKO.1 1767 CDS 100% 2.640 1.848 N Mtbp n/a
6 TRCN0000248196 TACCCTTGGCTGACCTATATG pLKO_005 600 CDS 100% 0.000 0.000 N Mtbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.