Transcript: Mouse XM_011245454.1

PREDICTED: Mus musculus frizzled class receptor 6 (Fzd6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fzd6 (14368)
Length:
3840
CDS:
218..2200

Additional Resources:

NCBI RefSeq record:
XM_011245454.1
NBCI Gene record:
Fzd6 (14368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337611 ACCAACTGATTTGTCTTATAA pLKO_005 2251 3UTR 100% 15.000 21.000 N Fzd6 n/a
2 TRCN0000071618 CCTAACCTGATGGGTCATTAT pLKO.1 38 5UTR 100% 13.200 18.480 N Fzd6 n/a
3 TRCN0000337688 ACCGTTGTCCTAGGGTCAAAG pLKO_005 884 CDS 100% 10.800 15.120 N Fzd6 n/a
4 TRCN0000071619 GCTCGACCAGAATTGGCTTTA pLKO.1 1475 CDS 100% 10.800 15.120 N Fzd6 n/a
5 TRCN0000071622 CCTTAGTGACACTTCTCGGTT pLKO.1 1350 CDS 100% 2.640 3.696 N Fzd6 n/a
6 TRCN0000337614 GGCAATAGCACGGCTTGTAAT pLKO_005 833 CDS 100% 13.200 10.560 N Fzd6 n/a
7 TRCN0000337687 AGTTCTACCCTGTCGGAAATT pLKO_005 343 CDS 100% 13.200 9.240 N Fzd6 n/a
8 TRCN0000337689 CCCTAACCTGATGGGTCATTA pLKO_005 37 5UTR 100% 13.200 9.240 N Fzd6 n/a
9 TRCN0000071621 CTCCAAGTGAAGGAAGGGTAA pLKO.1 2016 CDS 100% 4.050 2.835 N Fzd6 n/a
10 TRCN0000071620 GCAACTCTGTTCACGTTCCTT pLKO.1 704 CDS 100% 3.000 2.100 N Fzd6 n/a
11 TRCN0000357045 ACCCAGAGAGACCAATTATAT pLKO_005 756 CDS 100% 15.000 10.500 N FZD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.