Transcript: Mouse XM_011245505.1

PREDICTED: Mus musculus poly(rC) binding protein 2 (Pcbp2), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcbp2 (18521)
Length:
1907
CDS:
155..1465

Additional Resources:

NCBI RefSeq record:
XM_011245505.1
NBCI Gene record:
Pcbp2 (18521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120931 TCCTGAGAGAATTATCACTTT pLKO.1 316 CDS 100% 4.950 6.930 N Pcbp2 n/a
2 TRCN0000328932 TCCTGAGAGAATTATCACTTT pLKO_005 316 CDS 100% 4.950 6.930 N Pcbp2 n/a
3 TRCN0000375062 GGCAATGCAACAGTCTCATTT pLKO_005 796 CDS 100% 13.200 9.240 N Pcbp2 n/a
4 TRCN0000074686 ACCGGATTCAGTGGCATTGAA pLKO.1 836 CDS 100% 5.625 3.938 N PCBP2 n/a
5 TRCN0000120930 GCAGCTCTATGACCAATAGTA pLKO.1 405 CDS 100% 5.625 3.938 N Pcbp2 n/a
6 TRCN0000328933 GCAGCTCTATGACCAATAGTA pLKO_005 405 CDS 100% 5.625 3.938 N Pcbp2 n/a
7 TRCN0000120929 GCACGTATCAACATCTCAGAA pLKO.1 287 CDS 100% 4.950 3.465 N Pcbp2 n/a
8 TRCN0000328864 GCACGTATCAACATCTCAGAA pLKO_005 287 CDS 100% 4.950 3.465 N Pcbp2 n/a
9 TRCN0000120928 GCAATCACTATTGCTGGCATT pLKO.1 587 CDS 100% 0.405 0.284 N Pcbp2 n/a
10 TRCN0000375061 TAGTCAGTGTGGCTCTCTTAT pLKO_005 472 CDS 100% 13.200 7.920 N Pcbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.