Transcript: Mouse XM_011245544.1

PREDICTED: Mus musculus metastasis suppressor 1 (Mtss1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtss1 (211401)
Length:
4539
CDS:
16..2343

Additional Resources:

NCBI RefSeq record:
XM_011245544.1
NBCI Gene record:
Mtss1 (211401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174279 CGCGAACGAACTCTTTAATTA pLKO.1 2374 3UTR 100% 15.000 21.000 N Mtss1 n/a
2 TRCN0000176241 GTGTCAGCAATATACCCTCTT pLKO.1 2042 CDS 100% 4.050 3.240 N Mtss1 n/a
3 TRCN0000279397 CCAGGATGTCAACGATAAATA pLKO_005 348 CDS 100% 15.000 10.500 N Mtss1 n/a
4 TRCN0000193559 GCGAACGAACTCTTTAATTAA pLKO.1 2375 3UTR 100% 15.000 10.500 N Mtss1 n/a
5 TRCN0000279395 CCCACGACTCAGGATTCATAT pLKO_005 806 CDS 100% 13.200 9.240 N Mtss1 n/a
6 TRCN0000279405 CCTTCCTGACTACGCTCATTA pLKO_005 1128 CDS 100% 13.200 9.240 N Mtss1 n/a
7 TRCN0000216462 GAAAGCTCGACAAGAGATAAA pLKO.1 231 CDS 100% 13.200 9.240 N Mtss1 n/a
8 TRCN0000278701 TTGATCGATTGCCTGATAAAC pLKO_005 136 CDS 100% 13.200 9.240 N Mtss1 n/a
9 TRCN0000193871 CGAGGAAGAGATTTCCATGTT pLKO.1 468 CDS 100% 4.950 3.465 N Mtss1 n/a
10 TRCN0000279403 CGAGGAAGAGATTTCCATGTT pLKO_005 468 CDS 100% 4.950 3.465 N Mtss1 n/a
11 TRCN0000193839 CCAGTACAACTATGTCCAGAA pLKO.1 638 CDS 100% 4.050 2.835 N Mtss1 n/a
12 TRCN0000447397 TGACCATGGACCCTCACAAAC pLKO_005 536 CDS 100% 10.800 6.480 N MTSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.