Transcript: Mouse XM_011245603.1

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 3 (Rapgef3), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgef3 (223864)
Length:
2411
CDS:
298..1803

Additional Resources:

NCBI RefSeq record:
XM_011245603.1
NBCI Gene record:
Rapgef3 (223864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271700 TAGAGAACCTCATCAACTTTG pLKO_005 1529 CDS 100% 10.800 15.120 N Rapgef3 n/a
2 TRCN0000071954 CACGGCAAAGTGGTCTTAGTT pLKO.1 35 5UTR 100% 5.625 7.875 N Rapgef3 n/a
3 TRCN0000281826 TGTCAGCTATGGAGATCTTTG pLKO_005 1958 3UTR 100% 10.800 8.640 N Rapgef3 n/a
4 TRCN0000071955 CGCCTCTATCACCACTCAGAA pLKO.1 1613 CDS 100% 4.950 3.465 N Rapgef3 n/a
5 TRCN0000071953 GCTACTCAGGAAGTTCATCAA pLKO.1 1230 CDS 100% 4.950 3.465 N Rapgef3 n/a
6 TRCN0000071957 CTTAGCAACTTGCTGAGGGAA pLKO.1 529 CDS 100% 2.640 1.848 N Rapgef3 n/a
7 TRCN0000336560 AGGTGTTGGTGAAGGTCAATT pLKO_005 818 CDS 100% 13.200 7.920 N Rapgef3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.