Transcript: Mouse XM_011245706.2

PREDICTED: Mus musculus parvin, gamma (Parvg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Parvg (64099)
Length:
3115
CDS:
626..1621

Additional Resources:

NCBI RefSeq record:
XM_011245706.2
NBCI Gene record:
Parvg (64099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184197 GCAGGCCACTCATAAGTGTTA pLKO.1 2691 3UTR 100% 4.950 6.930 N Parvg n/a
2 TRCN0000183974 CCCTGTCAACCCTGAAGATAT pLKO.1 1495 CDS 100% 13.200 9.240 N Parvg n/a
3 TRCN0000180486 GAGCACACTGAGGATACTTTA pLKO.1 1534 CDS 100% 13.200 9.240 N Parvg n/a
4 TRCN0000184746 CCAGTCTGTCTACTAAGGCTA pLKO.1 1935 3UTR 100% 2.640 1.848 N Parvg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.