Transcript: Mouse XM_011245895.2

PREDICTED: Mus musculus CD200 receptor 4 (Cd200r4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd200r4 (239849)
Length:
3637
CDS:
2260..2934

Additional Resources:

NCBI RefSeq record:
XM_011245895.2
NBCI Gene record:
Cd200r4 (239849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112617 CAATGTCTGTACAGATGGATA pLKO.1 2258 5UTR 100% 4.950 3.465 N Cd200r4 n/a
2 TRCN0000112616 GTCCACTGATAAATGCAGTAT pLKO.1 2306 CDS 100% 4.950 3.465 N Cd200r4 n/a
3 TRCN0000112619 TAGAACTGAGTCAAGGTACAA pLKO.1 2798 CDS 100% 4.950 3.465 N Cd200r4 n/a
4 TRCN0000112615 CCTGCTGTCTTCATGTTTGTT pLKO.1 3031 3UTR 100% 5.625 2.813 Y Cd200r4 n/a
5 TRCN0000112628 GCAGTATTAATCACATGGATA pLKO.1 2320 CDS 100% 4.950 2.475 Y F630003A18Rik n/a
6 TRCN0000112618 GCTTTCTTCCAGAAGAGAAAT pLKO.1 2899 CDS 100% 1.320 0.660 Y Cd200r4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.