Transcript: Mouse XM_011245975.1

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (St3gal6), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal6 (54613)
Length:
2545
CDS:
681..1640

Additional Resources:

NCBI RefSeq record:
XM_011245975.1
NBCI Gene record:
St3gal6 (54613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077115 GTGGAAATACTGCTAGGTAAA pLKO.1 1242 CDS 100% 10.800 7.560 N St3gal6 n/a
2 TRCN0000302856 GTGGAAATACTGCTAGGTAAA pLKO_005 1242 CDS 100% 10.800 7.560 N St3gal6 n/a
3 TRCN0000077114 GCAACAATTGACTCCTATGAT pLKO.1 1050 CDS 100% 5.625 3.938 N St3gal6 n/a
4 TRCN0000302940 GCAACAATTGACTCCTATGAT pLKO_005 1050 CDS 100% 5.625 3.938 N St3gal6 n/a
5 TRCN0000077116 GAGGACTAGAAACAATGTCAA pLKO.1 788 CDS 100% 4.950 3.465 N St3gal6 n/a
6 TRCN0000302855 GAGGACTAGAAACAATGTCAA pLKO_005 788 CDS 100% 4.950 3.465 N St3gal6 n/a
7 TRCN0000077113 CCTTTACACTACTACGGGAAT pLKO.1 1515 CDS 100% 4.050 2.835 N St3gal6 n/a
8 TRCN0000302858 CCTTTACACTACTACGGGAAT pLKO_005 1515 CDS 100% 4.050 2.835 N St3gal6 n/a
9 TRCN0000077117 GCCTTTCACATATGCAGTGAA pLKO.1 1449 CDS 100% 0.000 0.000 N St3gal6 n/a
10 TRCN0000302857 GCCTTTCACATATGCAGTGAA pLKO_005 1449 CDS 100% 0.000 0.000 N St3gal6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.