Transcript: Mouse XM_011246020.1

PREDICTED: Mus musculus zinc finger protein 654 (Zfp654), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp654 (72020)
Length:
1298
CDS:
226..1209

Additional Resources:

NCBI RefSeq record:
XM_011246020.1
NBCI Gene record:
Zfp654 (72020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239617 CTGTAAGAGTGGAATTGATAT pLKO_005 996 CDS 100% 13.200 18.480 N n/a
2 TRCN0000239616 TGAAGCAATGGCTCTTATTAA pLKO_005 855 CDS 100% 15.000 10.500 N n/a
3 TRCN0000239618 ACCTGTAGAAGATCAGCTATT pLKO_005 951 CDS 100% 10.800 7.560 N n/a
4 TRCN0000239620 CAGAACCACCTCCGCAGATAT pLKO_005 646 CDS 100% 13.200 7.920 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.