Transcript: Mouse XM_011246100.2

PREDICTED: Mus musculus interferon (alpha and beta) receptor 2 (Ifnar2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ifnar2 (15976)
Length:
2723
CDS:
509..1744

Additional Resources:

NCBI RefSeq record:
XM_011246100.2
NBCI Gene record:
Ifnar2 (15976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304317 GATTGGTTATATATGCCTAAA pLKO_005 997 CDS 100% 10.800 15.120 N Ifnar2 n/a
2 TRCN0000304281 TTTCGTGAGCACTATCGTAAT pLKO_005 967 CDS 100% 10.800 15.120 N Ifnar2 n/a
3 TRCN0000067316 GTCTTGAACTTCCGCCACTTT pLKO.1 1034 CDS 100% 4.950 6.930 N Ifnar2 n/a
4 TRCN0000067314 CCGCCAGAATTTGAGATCGTT pLKO.1 608 CDS 100% 3.000 4.200 N Ifnar2 n/a
5 TRCN0000301550 CCGCCAGAATTTGAGATCGTT pLKO_005 608 CDS 100% 3.000 4.200 N Ifnar2 n/a
6 TRCN0000067313 CCCTATGTTGTTTCTAGGAAA pLKO.1 2045 3UTR 100% 4.950 3.960 N Ifnar2 n/a
7 TRCN0000304279 CTCTATGCAGATTGACAATTT pLKO_005 1887 3UTR 100% 13.200 9.240 N Ifnar2 n/a
8 TRCN0000067315 CGTGAACTTAAACTCTGTGTT pLKO.1 1483 CDS 100% 4.950 3.465 N Ifnar2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.