Transcript: Mouse XM_011246108.2

PREDICTED: Mus musculus Son DNA binding protein (Son), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Son (20658)
Length:
8032
CDS:
763..7149

Additional Resources:

NCBI RefSeq record:
XM_011246108.2
NBCI Gene record:
Son (20658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102294 CGGTCAGATTAAGGCGATCAA pLKO.1 5810 CDS 100% 4.950 6.930 N Son n/a
2 TRCN0000287317 CGGTCAGATTAAGGCGATCAA pLKO_005 5810 CDS 100% 4.950 6.930 N Son n/a
3 TRCN0000303984 ACAGCGCTGGAATCCTATAAT pLKO_005 1735 CDS 100% 15.000 12.000 N SON n/a
4 TRCN0000307414 ACAGCGCTGGAATCCTATAAT pLKO_005 1735 CDS 100% 15.000 12.000 N Son n/a
5 TRCN0000303863 AGGAGTGCCTCACGTAGATAG pLKO_005 7129 CDS 100% 10.800 8.640 N SON n/a
6 TRCN0000083724 CGCTCTATGATGTCAGCTTAT pLKO.1 2890 CDS 100% 10.800 8.640 N SON n/a
7 TRCN0000300022 CGCTCTATGATGTCAGCTTAT pLKO_005 2890 CDS 100% 10.800 8.640 N SON n/a
8 TRCN0000102292 CGCTCTATGATGTCTTATGAA pLKO.1 2743 CDS 100% 5.625 4.500 N Son n/a
9 TRCN0000102291 GCTGACTTAGTGAGACCATTA pLKO.1 4981 CDS 100% 10.800 7.560 N Son n/a
10 TRCN0000287247 GCTGACTTAGTGAGACCATTA pLKO_005 4981 CDS 100% 10.800 7.560 N Son n/a
11 TRCN0000083723 CCCTAATAAGAAGCATGCTAA pLKO.1 7032 CDS 100% 4.950 3.465 N SON n/a
12 TRCN0000102293 CCTTACTGTAAACAGTCATTT pLKO.1 4401 CDS 100% 13.200 7.920 N Son n/a
13 TRCN0000287249 CCTTACTGTAAACAGTCATTT pLKO_005 4401 CDS 100% 13.200 7.920 N Son n/a
14 TRCN0000303921 ACACCATGGAGACCCATATAT pLKO_005 1856 CDS 100% 15.000 10.500 N SON n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.