Transcript: Mouse XM_011246362.2

PREDICTED: Mus musculus RAB11 family interacting protein 3 (class II) (Rab11fip3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab11fip3 (215445)
Length:
4294
CDS:
374..2896

Additional Resources:

NCBI RefSeq record:
XM_011246362.2
NBCI Gene record:
Rab11fip3 (215445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189166 GCCGATGAGTTTGACGACTTT pLKO.1 2123 CDS 100% 4.950 6.930 N Rab11fip3 n/a
2 TRCN0000188486 CCGATGCACTTCACTGTTGTT pLKO.1 1434 CDS 100% 4.950 3.960 N Rab11fip3 n/a
3 TRCN0000420612 GATTGGCAGTGAGGAACATTT pLKO_005 2401 CDS 100% 13.200 9.240 N Rab11fip3 n/a
4 TRCN0000427981 GGGCAATGAGGCAGAACTATC pLKO_005 2437 CDS 100% 10.800 7.560 N Rab11fip3 n/a
5 TRCN0000056477 GCAGGTGAAGGACTTAACTAA pLKO.1 1966 CDS 100% 5.625 3.938 N RAB11FIP3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3434 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.