Transcript: Mouse XM_011246381.1

PREDICTED: Mus musculus xanthine dehydrogenase (Xdh), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xdh (22436)
Length:
3010
CDS:
84..2483

Additional Resources:

NCBI RefSeq record:
XM_011246381.1
NBCI Gene record:
Xdh (22436)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319596 GGATCTCTCTCGGAGTATAAT pLKO_005 1097 CDS 100% 15.000 21.000 N Xdh n/a
2 TRCN0000041278 GCTGTGTATAATCCCGACTAA pLKO.1 1475 CDS 100% 4.950 6.930 N Xdh n/a
3 TRCN0000041280 CGGGAGGATTTGTAAGACTAA pLKO.1 1175 CDS 100% 4.950 3.960 N Xdh n/a
4 TRCN0000317848 CGGGAGGATTTGTAAGACTAA pLKO_005 1175 CDS 100% 4.950 3.960 N Xdh n/a
5 TRCN0000319595 CACAATCCAGGATGCTATAAA pLKO_005 572 CDS 100% 15.000 10.500 N Xdh n/a
6 TRCN0000319662 TTGAGTAATTCTGGGTAATTC pLKO_005 2686 3UTR 100% 13.200 9.240 N Xdh n/a
7 TRCN0000041282 GCTTGAATCCTGCCATTGATA pLKO.1 2038 CDS 100% 5.625 3.938 N Xdh n/a
8 TRCN0000028089 GCTATAAAGAACAACTCCTTT pLKO.1 585 CDS 100% 4.950 3.465 N XDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.