Transcript: Mouse XM_011246426.2

PREDICTED: Mus musculus zinc finger protein 52 (Zfp52), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp52 (22710)
Length:
4078
CDS:
608..2782

Additional Resources:

NCBI RefSeq record:
XM_011246426.2
NBCI Gene record:
Zfp52 (22710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428406 GCTCAACGAAATGCTTCATGA pLKO_005 835 CDS 100% 4.950 3.960 N Zfp52 n/a
2 TRCN0000423812 ATCAAATGAGATAAGTGATTG pLKO_005 2810 3UTR 100% 10.800 7.560 N Zfp52 n/a
3 TRCN0000436677 AGTTACTTGTGCAGTTATCTG pLKO_005 1353 CDS 100% 4.950 3.465 N Zfp52 n/a
4 TRCN0000084650 CCAAGTGCAAAGATTGTGATA pLKO.1 1836 CDS 100% 4.950 3.465 N Zfp52 n/a
5 TRCN0000084651 GCATACGGCAAAGAAACCATA pLKO.1 1312 CDS 100% 4.950 3.465 N Zfp52 n/a
6 TRCN0000084652 CGGATTTCTAGTGTTAGAATA pLKO.1 1868 CDS 100% 1.320 0.792 N Zfp52 n/a
7 TRCN0000084649 CCGGATTTCTAGTGTTAGAAT pLKO.1 1867 CDS 100% 0.563 0.338 N Zfp52 n/a
8 TRCN0000084648 GCTGTTTATATGTTGGGAATT pLKO.1 3077 3UTR 100% 0.000 0.000 N Zfp52 n/a
9 TRCN0000235274 ATACTGGAGAGAGACCTTATG pLKO_005 1986 CDS 100% 10.800 5.400 Y Gm10771 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.