Transcript: Mouse XM_011246503.2

PREDICTED: Mus musculus acyl-CoA synthetase bubblegum family member 2 (Acsbg2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsbg2 (328845)
Length:
1826
CDS:
91..1518

Additional Resources:

NCBI RefSeq record:
XM_011246503.2
NBCI Gene record:
Acsbg2 (328845)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251277 CAACCACTGTGTCGGACATTT pLKO_005 1280 CDS 100% 13.200 10.560 N Acsbg2 n/a
2 TRCN0000251278 ATATCACTGGCCGCATCAAAG pLKO_005 1034 CDS 100% 10.800 8.640 N Acsbg2 n/a
3 TRCN0000251279 ATGGCATAGACATCGTGAATC pLKO_005 1340 CDS 100% 10.800 8.640 N Acsbg2 n/a
4 TRCN0000258156 ACAAGCCTTCCAGGCGTAAGT pLKO_005 1654 3UTR 100% 4.950 3.960 N Acsbg2 n/a
5 TRCN0000251276 TCGCAAGAGATGGAGATAAAC pLKO_005 268 CDS 100% 13.200 9.240 N Acsbg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.