Transcript: Mouse XM_011246552.2

PREDICTED: Mus musculus perilipin 4 (Plin4), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plin4 (57435)
Length:
6504
CDS:
279..5084

Additional Resources:

NCBI RefSeq record:
XM_011246552.2
NBCI Gene record:
Plin4 (57435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176155 GCCAAGTTATTGGTGGCTATT pLKO.1 6101 3UTR 100% 10.800 8.640 N Plin4 n/a
2 TRCN0000339349 GCCAAGTTATTGGTGGCTATT pLKO_005 6101 3UTR 100% 10.800 8.640 N Plin4 n/a
3 TRCN0000194055 GAATGTCCTCACCAATACGAA pLKO.1 749 CDS 100% 3.000 2.400 N Plin4 n/a
4 TRCN0000339347 GAATGTCCTCACCAATACGAA pLKO_005 749 CDS 100% 3.000 2.400 N Plin4 n/a
5 TRCN0000194414 CTGGCACAAAGGACACTGTAT pLKO.1 1156 CDS 100% 4.950 3.465 N Plin4 n/a
6 TRCN0000339348 CTGGCACAAAGGACACTGTAT pLKO_005 1156 CDS 100% 4.950 3.465 N Plin4 n/a
7 TRCN0000174394 CAAAGGACTTACAAACAGCAA pLKO.1 412 CDS 100% 2.640 1.848 N Plin4 n/a
8 TRCN0000351087 CAAAGGACTTACAAACAGCAA pLKO_005 412 CDS 100% 2.640 1.848 N Plin4 n/a
9 TRCN0000173205 CAGGAGCCATTAATGTGGCTA pLKO.1 1486 CDS 100% 0.264 0.185 N Plin4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.