Transcript: Mouse XM_011246671.2

PREDICTED: Mus musculus tight junction associated protein 1 (Tjap1), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tjap1 (74094)
Length:
2459
CDS:
271..1920

Additional Resources:

NCBI RefSeq record:
XM_011246671.2
NBCI Gene record:
Tjap1 (74094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202423 GCTGAGGATGTATTCGTGCAT pLKO.1 1045 CDS 100% 2.640 3.696 N Tjap1 n/a
2 TRCN0000328440 GCTGAGGATGTATTCGTGCAT pLKO_005 1045 CDS 100% 2.640 3.696 N Tjap1 n/a
3 TRCN0000328442 ATGCCAGGAACACCATCAATA pLKO_005 728 CDS 100% 13.200 10.560 N Tjap1 n/a
4 TRCN0000328377 GTCTCCACCACACCCATTATA pLKO_005 1212 CDS 100% 15.000 10.500 N Tjap1 n/a
5 TRCN0000328379 TGAGGAGCTGGACAAGTTTAA pLKO_005 525 CDS 100% 13.200 9.240 N Tjap1 n/a
6 TRCN0000190147 GCCCGAGCTACAATTGCATTT pLKO.1 1572 CDS 100% 10.800 7.560 N Tjap1 n/a
7 TRCN0000328441 TGGTGCTGCTGACCTCTATTC pLKO_005 2231 3UTR 100% 10.800 7.560 N Tjap1 n/a
8 TRCN0000189580 CCCATTATACCCTGGTAGGAA pLKO.1 1224 CDS 100% 3.000 2.100 N Tjap1 n/a
9 TRCN0000201909 CAAGTGCAACAAGTCCCACTT pLKO.1 807 CDS 100% 0.405 0.284 N Tjap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.