Transcript: Mouse XM_011246860.2

PREDICTED: Mus musculus purine rich element binding protein A (Pura), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pura (19290)
Length:
5636
CDS:
272..1237

Additional Resources:

NCBI RefSeq record:
XM_011246860.2
NBCI Gene record:
Pura (19290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014535 CGGACACACCTTCTGCAAGTA pLKO.1 1069 CDS 100% 4.950 6.930 N PURA n/a
2 TRCN0000280356 CGGACACACCTTCTGCAAGTA pLKO_005 1069 CDS 100% 4.950 6.930 N PURA n/a
3 TRCN0000103572 CGTGTTTATGCGAGTGAGTGA pLKO.1 991 CDS 100% 2.640 3.696 N Pura n/a
4 TRCN0000280415 GTACACGTTTAAGCTATTATT pLKO_005 1603 3UTR 100% 15.000 10.500 N PURA n/a
5 TRCN0000014533 CCAACAAGTACGGCGTGTTTA pLKO.1 978 CDS 100% 13.200 9.240 N PURA n/a
6 TRCN0000103570 CGATGTGGGTTCCAACAAGTA pLKO.1 967 CDS 100% 4.950 3.465 N Pura n/a
7 TRCN0000103573 CACCTCCTTGACTGTGGACAA pLKO.1 931 CDS 100% 4.050 2.835 N Pura n/a
8 TRCN0000103571 CCGTTTCCTGAAGATCGCAGA pLKO.1 517 CDS 100% 2.160 1.512 N Pura n/a
9 TRCN0000103574 GCCCTACAAGGTGTGGGCCAA pLKO.1 1045 CDS 100% 0.000 0.000 N Pura n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1253 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.