Transcript: Mouse XM_011246903.2

PREDICTED: Mus musculus PR domain containing 6 (Prdm6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prdm6 (225518)
Length:
2420
CDS:
485..2308

Additional Resources:

NCBI RefSeq record:
XM_011246903.2
NBCI Gene record:
Prdm6 (225518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239261 CCCAACAACCGTTGCGATATG pLKO_005 1070 CDS 100% 10.800 15.120 N Prdm6 n/a
2 TRCN0000239260 GAACGTCCCTTCCACCGTAAT pLKO_005 1642 CDS 100% 10.800 15.120 N Prdm6 n/a
3 TRCN0000239259 GTTCAGTACAGGTCGAATATA pLKO_005 1505 CDS 100% 15.000 12.000 N Prdm6 n/a
4 TRCN0000254035 GTTCAGTACAGGTCGAATATA pLKO_005 1505 CDS 100% 15.000 12.000 N PRDM6 n/a
5 TRCN0000254038 CAGCATCTCTGGGAGATATAT pLKO_005 1373 CDS 100% 15.000 10.500 N PRDM6 n/a
6 TRCN0000238689 CTACCGAGCCTGTATAGATAT pLKO_005 1528 CDS 100% 13.200 9.240 N Prdm6 n/a
7 TRCN0000254037 CTACCGAGCCTGTATAGATAT pLKO_005 1528 CDS 100% 13.200 9.240 N PRDM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.