Transcript: Mouse XM_011246913.2

PREDICTED: Mus musculus metallophosphoesterase 1 (Mppe1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mppe1 (225651)
Length:
1815
CDS:
112..1161

Additional Resources:

NCBI RefSeq record:
XM_011246913.2
NBCI Gene record:
Mppe1 (225651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249526 CTCAGAGAGATCTCTCGTAAA pLKO_005 601 CDS 100% 10.800 8.640 N Mppe1 n/a
2 TRCN0000215964 CCACTATCAGATGAGTAAATA pLKO.1 378 CDS 100% 15.000 10.500 N Mppe1 n/a
3 TRCN0000249530 CCACTATCAGATGAGTAAATA pLKO_005 378 CDS 100% 15.000 10.500 N Mppe1 n/a
4 TRCN0000249527 TGCAGCTGAAGGTGGTCATTG pLKO_005 338 CDS 100% 10.800 7.560 N Mppe1 n/a
5 TRCN0000195953 CCCATCTTTCAGTTGGAGGAA pLKO.1 933 CDS 100% 2.640 1.848 N Mppe1 n/a
6 TRCN0000249529 CTCTCTCTGAAAGGAGTTAAT pLKO_005 442 CDS 100% 13.200 9.240 N Mppe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.