Transcript: Mouse XM_011246970.2

PREDICTED: Mus musculus growth regulation by estrogen in breast cancer-like (Greb1l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Greb1l (381157)
Length:
8999
CDS:
667..6537

Additional Resources:

NCBI RefSeq record:
XM_011246970.2
NBCI Gene record:
Greb1l (381157)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251635 TTAATCGACTCAAGCTATTTA pLKO_005 3964 CDS 100% 15.000 21.000 N Greb1l n/a
2 TRCN0000251634 ACCCAGTATGCAGCCTATAAT pLKO_005 5053 CDS 100% 15.000 10.500 N Greb1l n/a
3 TRCN0000251633 CCTTCAACATGCCTCATATAA pLKO_005 6138 CDS 100% 15.000 10.500 N Greb1l n/a
4 TRCN0000251636 GACAGTTCACACAGGTTAATA pLKO_005 8712 3UTR 100% 15.000 10.500 N Greb1l n/a
5 TRCN0000005374 GCTGCTATGATTCCCACACAA pLKO.1 2752 CDS 100% 4.950 3.465 N GREB1L n/a
6 TRCN0000005372 CCCTATTTCTATGGAAATGTT pLKO.1 2017 CDS 100% 0.563 0.394 N GREB1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.