Transcript: Mouse XM_011247218.1

PREDICTED: Mus musculus ligand dependent nuclear receptor corepressor (Lcor), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lcor (212391)
Length:
15239
CDS:
524..5614

Additional Resources:

NCBI RefSeq record:
XM_011247218.1
NBCI Gene record:
Lcor (212391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201278 GCCAGGTATGTAGGAATTACA pLKO.1 12666 3UTR 100% 5.625 4.500 N AI606181 n/a
2 TRCN0000200641 CGTGATCTCATGGCATTATTT pLKO.1 14245 3UTR 100% 15.000 10.500 N AI606181 n/a
3 TRCN0000016305 CCAGCCCAATAGCACAAAGAA pLKO.1 592 CDS 100% 5.625 3.938 N LCOR n/a
4 TRCN0000085105 CCAATAGCACAAAGAACCAAA pLKO.1 597 CDS 100% 4.950 3.465 N Lcor n/a
5 TRCN0000201142 CATCTGTCACTTAGTCACTCT pLKO.1 12594 3UTR 100% 2.640 1.848 N AI606181 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.