Transcript: Mouse XM_011247219.2

PREDICTED: Mus musculus tight junction protein 2 (Tjp2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tjp2 (21873)
Length:
4459
CDS:
177..3680

Additional Resources:

NCBI RefSeq record:
XM_011247219.2
NBCI Gene record:
Tjp2 (21873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421477 AGAATGCGAGGATCGAAATAG pLKO_005 3418 CDS 100% 13.200 18.480 N Tjp2 n/a
2 TRCN0000417006 GAAACGACGTTGGGATATTTG pLKO_005 1699 CDS 100% 13.200 18.480 N Tjp2 n/a
3 TRCN0000091772 CTTCGACTACTCCAAGTCAAA pLKO.1 3140 CDS 100% 4.950 6.930 N Tjp2 n/a
4 TRCN0000091770 CGCTCCTATCACGAAGCTTAT pLKO.1 846 CDS 100% 10.800 8.640 N Tjp2 n/a
5 TRCN0000091769 CGGCACTGTTACTGAGAACAT pLKO.1 1178 CDS 100% 4.950 3.960 N Tjp2 n/a
6 TRCN0000436114 AGATGTGAAGAGGGAGTTAAA pLKO_005 3986 3UTR 100% 13.200 9.240 N Tjp2 n/a
7 TRCN0000428260 GATTCCAGACAAGGTGTTAAA pLKO_005 2568 CDS 100% 13.200 9.240 N Tjp2 n/a
8 TRCN0000425618 GCTTCATGCAAACCCATAATG pLKO_005 4116 3UTR 100% 13.200 9.240 N Tjp2 n/a
9 TRCN0000091771 GCCTACACTGACAATGAGCTA pLKO.1 2913 CDS 100% 2.640 1.848 N Tjp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.