Transcript: Mouse XM_011247225.2

PREDICTED: Mus musculus nicotinamide riboside kinase 1 (Nmrk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nmrk1 (225994)
Length:
2226
CDS:
640..1041

Additional Resources:

NCBI RefSeq record:
XM_011247225.2
NBCI Gene record:
Nmrk1 (225994)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217442 GATGTGCTTGAAGCGCTAAAT pLKO.1 619 5UTR 100% 13.200 18.480 N Nmrk1 n/a
2 TRCN0000244615 GATGTGCTTGAAGCGCTAAAT pLKO_005 619 5UTR 100% 13.200 18.480 N Nmrk1 n/a
3 TRCN0000192854 GAGAAGGAGTACCAGAGTATA pLKO.1 834 CDS 100% 13.200 10.560 N Nmrk1 n/a
4 TRCN0000244613 TTTGTGCTTGTAGCCATAAAT pLKO_005 1691 3UTR 100% 15.000 10.500 N Nmrk1 n/a
5 TRCN0000216693 CATCACCTGGGACATTGTTTA pLKO.1 933 CDS 100% 13.200 9.240 N Nmrk1 n/a
6 TRCN0000244617 TTCCCAACTGCAGCGTCATAT pLKO_005 533 5UTR 100% 13.200 9.240 N Nmrk1 n/a
7 TRCN0000244616 ATAAGCCTCTGGACACCATAT pLKO_005 767 CDS 100% 10.800 7.560 N Nmrk1 n/a
8 TRCN0000244614 CAGAGTCTGAGATAGACATAG pLKO_005 575 5UTR 100% 10.800 7.560 N Nmrk1 n/a
9 TRCN0000191996 GAGTCTGAGATAGACATAGAT pLKO.1 577 5UTR 100% 5.625 3.938 N Nmrk1 n/a
10 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 1825 3UTR 100% 13.200 6.600 Y Ptcra n/a
11 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 1833 3UTR 100% 2.640 1.320 Y Adsl n/a
12 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 1833 3UTR 100% 2.640 1.320 Y Adsl n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1579 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.