Transcript: Mouse XM_011247235.1

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 70 (Cyp2c70), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c70 (226105)
Length:
1542
CDS:
242..1327

Additional Resources:

NCBI RefSeq record:
XM_011247235.1
NBCI Gene record:
Cyp2c70 (226105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418761 CAACGAGTTCCACAGTGAAAT pLKO_005 756 CDS 100% 13.200 18.480 N Cyp2c70 n/a
2 TRCN0000427950 AGTTCATCTTGGAGGAAATAA pLKO_005 579 CDS 100% 15.000 10.500 N Cyp2c70 n/a
3 TRCN0000422924 ATGTGATCTCTACTGTCATTT pLKO_005 384 CDS 100% 13.200 9.240 N Cyp2c70 n/a
4 TRCN0000127357 GCAGGAAGAAGAGCTTGTATT pLKO.1 1142 CDS 100% 13.200 9.240 N Cyp2c70 n/a
5 TRCN0000127358 CCTTTACCAATTGTTGGAAAT pLKO.1 123 5UTR 100% 10.800 7.560 N Cyp2c70 n/a
6 TRCN0000127355 GCCAGTTCAAACTGGTTTATT pLKO.1 1264 CDS 100% 1.500 1.050 N Cyp2c70 n/a
7 TRCN0000127354 CCTGCTTCTTCTGTGAGCAAA pLKO.1 1361 3UTR 100% 4.950 2.970 N Cyp2c70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.