Transcript: Mouse XM_011247373.2

PREDICTED: Mus musculus RNA binding motif protein 20 (Rbm20), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm20 (73713)
Length:
7099
CDS:
913..4206

Additional Resources:

NCBI RefSeq record:
XM_011247373.2
NBCI Gene record:
Rbm20 (73713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012133 GCGGTGATCTTTAAGATTATA pLKO.1 6873 3UTR 100% 15.000 21.000 N Rbm20 n/a
2 TRCN0000433665 GGGTCATCAACTGAACGATTT pLKO_005 1794 CDS 100% 10.800 15.120 N Rbm20 n/a
3 TRCN0000012135 GCACGGAGAATGACGTCATTA pLKO.1 2201 CDS 100% 13.200 9.240 N Rbm20 n/a
4 TRCN0000442128 TGGAGATGCCTGGCCTAAATC pLKO_005 3530 CDS 100% 13.200 9.240 N Rbm20 n/a
5 TRCN0000012136 CCATTCTGTGTCTGGCTACAA pLKO.1 2802 CDS 100% 4.950 3.465 N Rbm20 n/a
6 TRCN0000012134 CCCAGGTACATGGAAGTGAAA pLKO.1 3847 CDS 100% 4.950 3.465 N Rbm20 n/a
7 TRCN0000012137 CCTATTGACCAGAAAGACAAA pLKO.1 3343 CDS 100% 4.950 3.465 N Rbm20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247373.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.