Transcript: Mouse XM_011247532.2

PREDICTED: Mus musculus Rho GTPase activating protein 4 (Arhgap4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap4 (171207)
Length:
3363
CDS:
111..2990

Additional Resources:

NCBI RefSeq record:
XM_011247532.2
NBCI Gene record:
Arhgap4 (171207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071702 GCAACTACTACTTACACGATA pLKO.1 928 CDS 100% 4.950 6.930 N Arhgap4 n/a
2 TRCN0000071701 CCTACGCTATCTCTTCACCTT pLKO.1 2048 CDS 100% 2.640 3.696 N Arhgap4 n/a
3 TRCN0000071700 CATCCTAGATTCCAGTATAAT pLKO.1 1638 CDS 100% 15.000 10.500 N Arhgap4 n/a
4 TRCN0000071699 GCCAAGTACTTGGAGCATAAA pLKO.1 843 CDS 100% 13.200 9.240 N Arhgap4 n/a
5 TRCN0000071698 GCTCCTCTTATGCCTTTGCTT pLKO.1 3107 3UTR 100% 3.000 2.100 N Arhgap4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.