Transcript: Mouse XM_011247541.2

PREDICTED: Mus musculus CD99 antigen-like 2 (Cd99l2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cd99l2 (171486)
Length:
3646
CDS:
531..1031

Additional Resources:

NCBI RefSeq record:
XM_011247541.2
NBCI Gene record:
Cd99l2 (171486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111123 GATCTGGCATATCGACAGAAA pLKO.1 757 CDS 100% 4.950 6.930 N Cd99l2 n/a
2 TRCN0000111120 CCCAACTTCATGTTTCATATT pLKO.1 1656 3UTR 100% 13.200 9.240 N Cd99l2 n/a
3 TRCN0000111122 GATGCCTTGGATGATCGAAAT pLKO.1 503 5UTR 100% 10.800 7.560 N Cd99l2 n/a
4 TRCN0000111121 GCCTTGGATGATCGAAATGAT pLKO.1 506 5UTR 100% 5.625 3.938 N Cd99l2 n/a
5 TRCN0000111124 CCTATGGAACTAGATGGGTTT pLKO.1 473 5UTR 100% 4.050 2.835 N Cd99l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.