Transcript: Mouse XM_011247761.2

PREDICTED: Mus musculus microrchidia 4 (Morc4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Morc4 (75746)
Length:
3070
CDS:
8..2968

Additional Resources:

NCBI RefSeq record:
XM_011247761.2
NBCI Gene record:
Morc4 (75746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243872 TAAGCCTACCTCCACGAATAA pLKO_005 1237 CDS 100% 13.200 18.480 N Morc4 n/a
2 TRCN0000243870 GACTTCGATACAGATCAATAT pLKO_005 1016 CDS 100% 13.200 10.560 N Morc4 n/a
3 TRCN0000243873 ATCATAACAACCGCCTTATTA pLKO_005 1320 CDS 100% 15.000 10.500 N Morc4 n/a
4 TRCN0000176506 CCACTGGCATTCTGAATATAA pLKO.1 2692 CDS 100% 15.000 10.500 N Morc4 n/a
5 TRCN0000176507 CTGCTAGATAATGCTGTAGAT pLKO.1 485 CDS 100% 4.950 3.465 N Morc4 n/a
6 TRCN0000176844 GCCATCTTGAACTATTCGATT pLKO.1 884 CDS 100% 4.950 3.465 N Morc4 n/a
7 TRCN0000178363 GCCAGAAACAGAGTATTCCTT pLKO.1 1099 CDS 100% 3.000 2.100 N Morc4 n/a
8 TRCN0000243871 CATCGCGGAGCTGCTAGATAA pLKO_005 475 CDS 100% 13.200 7.920 N Morc4 n/a
9 TRCN0000177801 CCGGAGAAACAAAGATGGAAA pLKO.1 985 CDS 100% 4.950 2.970 N Morc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.