Transcript: Mouse XM_011247830.2

PREDICTED: Mus musculus WNK lysine deficient protein kinase 3 (Wnk3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wnk3 (279561)
Length:
10974
CDS:
635..5908

Additional Resources:

NCBI RefSeq record:
XM_011247830.2
NBCI Gene record:
Wnk3 (279561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360958 GAGCTACAGGACCGCAAATTA pLKO_005 1160 CDS 100% 15.000 21.000 N Wnk3 n/a
2 TRCN0000378290 GAACGCCTTCGAGCAACTAAA pLKO_005 5228 CDS 100% 13.200 18.480 N Wnk3 n/a
3 TRCN0000222246 GCCAAGTTTAAACCAACTCAA pLKO.1 5509 CDS 100% 4.950 6.930 N Wnk3 n/a
4 TRCN0000222243 CCACTCAAACTAGCAATGAAT pLKO.1 3093 CDS 100% 5.625 4.500 N Wnk3 n/a
5 TRCN0000222247 CCTGAGGAAGTAGCGTATGAA pLKO.1 2006 CDS 100% 5.625 4.500 N Wnk3 n/a
6 TRCN0000355859 CAATCCCTCCTGGTCCTAAAT pLKO_005 5886 CDS 100% 13.200 9.240 N WNK3 n/a
7 TRCN0000360906 GAACCTTAAAGACGTACTTAA pLKO_005 1329 CDS 100% 13.200 9.240 N Wnk3 n/a
8 TRCN0000001533 GCCTCACGTTTGTCAGTATAA pLKO.1 5713 CDS 100% 13.200 9.240 N WNK3 n/a
9 TRCN0000222245 CCCAGCGAGTTATGTTTACAT pLKO.1 4172 CDS 100% 5.625 3.938 N Wnk3 n/a
10 TRCN0000222244 GCTGACTATATGGTTGAAGAT pLKO.1 2888 CDS 100% 4.950 3.465 N Wnk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.