Transcript: Mouse XM_011247898.2

PREDICTED: Mus musculus Sp110 nuclear body protein (Sp110), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sp110 (109032)
Length:
2067
CDS:
357..1706

Additional Resources:

NCBI RefSeq record:
XM_011247898.2
NBCI Gene record:
Sp110 (109032)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225826 ACGTCCGAACTGGTCAAATTC pLKO_005 1109 CDS 100% 13.200 6.600 Y Sp110 n/a
2 TRCN0000194101 GATGAACTCCTGACCTGATAT pLKO.1 1709 3UTR 100% 13.200 6.600 Y Sp110 n/a
3 TRCN0000225827 GATGAACTCCTGACCTGATAT pLKO_005 1709 3UTR 100% 13.200 6.600 Y Sp110 n/a
4 TRCN0000218876 AGCTTCAGAAACGTTGGTTAT pLKO_005 660 CDS 100% 10.800 5.400 Y Sp110 n/a
5 TRCN0000225825 CAACCGCACAGCCAATCATTG pLKO_005 838 CDS 100% 10.800 5.400 Y Sp110 n/a
6 TRCN0000225824 CAAGGTCAACCTCCGGGAATA pLKO_005 614 CDS 100% 10.800 5.400 Y Sp110 n/a
7 TRCN0000176063 GCTCTTCTCCAGCATTTCATA pLKO.1 387 CDS 100% 5.625 2.813 Y Sp110 n/a
8 TRCN0000174047 CCAAGAATGACGCTGTGGATT pLKO.1 1420 CDS 100% 4.950 2.475 Y Sp110 n/a
9 TRCN0000193214 CTTTGTGGAAAGATGACTCAT pLKO.1 1246 CDS 100% 4.950 2.475 Y Sp110 n/a
10 TRCN0000173786 CAGATGAACTCCTGACCTGAT pLKO.1 1707 CDS 100% 4.050 2.025 Y Sp110 n/a
11 TRCN0000193944 CCAATCATTGAGATCCTGGAT pLKO.1 849 CDS 100% 2.640 1.320 Y Sp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.