Transcript: Mouse XM_011247916.2

PREDICTED: Mus musculus calcium channel, voltage-dependent, R type, alpha 1E subunit (Cacna1e), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacna1e (12290)
Length:
26042
CDS:
11493..18455

Additional Resources:

NCBI RefSeq record:
XM_011247916.2
NBCI Gene record:
Cacna1e (12290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443760 AGCTCTATGCGACGTTCATTT pLKO_005 17556 CDS 100% 13.200 18.480 N Cacna1e n/a
2 TRCN0000068909 GCGTTCAAATTCCTCCTGGTT pLKO.1 17594 CDS 100% 2.640 3.696 N Cacna1e n/a
3 TRCN0000454343 CTGACCTGGCCTACGTTTATT pLKO_005 16588 CDS 100% 15.000 12.000 N Cacna1e n/a
4 TRCN0000068910 CCGGCTCCTAAGGATATTTAA pLKO.1 13217 CDS 100% 15.000 10.500 N Cacna1e n/a
5 TRCN0000450497 GGAGAAGACAGAACCATATTT pLKO_005 11867 CDS 100% 15.000 10.500 N Cacna1e n/a
6 TRCN0000440277 CACCTATGAGCTCGCCTTAAA pLKO_005 16013 CDS 100% 13.200 9.240 N Cacna1e n/a
7 TRCN0000068911 CCCGGCTGGTTATGAATGTAA pLKO.1 12314 CDS 100% 5.625 3.938 N Cacna1e n/a
8 TRCN0000044721 CCGCATCCATTACACTGAGAT pLKO.1 16772 CDS 100% 4.950 3.465 N CACNA1E n/a
9 TRCN0000068912 CCTCACCACTTAGATGAGTTT pLKO.1 16713 CDS 100% 4.950 3.465 N Cacna1e n/a
10 TRCN0000068908 CGCTACTTTGAAATGTGCATT pLKO.1 14958 CDS 100% 4.950 3.465 N Cacna1e n/a
11 TRCN0000044720 GCCGCCATTTGAGTACATGAT pLKO.1 11759 CDS 100% 4.950 3.465 N CACNA1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.