Transcript: Mouse XM_011247942.1

PREDICTED: Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 2 (Serpinb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serpinb2 (18788)
Length:
2098
CDS:
147..1439

Additional Resources:

NCBI RefSeq record:
XM_011247942.1
NBCI Gene record:
Serpinb2 (18788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305136 ATTACCCACACGATACTATTT pLKO_005 1395 CDS 100% 13.200 18.480 N Serpinb2 n/a
2 TRCN0000305137 TGCTTACAGTATAACTCTATT pLKO_005 1598 3UTR 100% 13.200 18.480 N Serpinb2 n/a
3 TRCN0000080315 CCACAGTTTGTGGCCGATCAT pLKO.1 1347 CDS 100% 4.950 3.465 N Serpinb2 n/a
4 TRCN0000080316 CCCGAAGGTTCTGTAGATGAA pLKO.1 747 CDS 100% 4.950 3.465 N Serpinb2 n/a
5 TRCN0000308509 CCCGAAGGTTCTGTAGATGAA pLKO_005 747 CDS 100% 4.950 3.465 N Serpinb2 n/a
6 TRCN0000080314 GCTTTATCCTTTCCGTGTGAA pLKO.1 845 CDS 100% 4.950 3.465 N Serpinb2 n/a
7 TRCN0000308584 GCTTTATCCTTTCCGTGTGAA pLKO_005 845 CDS 100% 4.950 3.465 N Serpinb2 n/a
8 TRCN0000080317 AGATCCTAGAACTTCCGCATA pLKO.1 946 CDS 100% 4.050 2.835 N Serpinb2 n/a
9 TRCN0000308499 AGATCCTAGAACTTCCGCATA pLKO_005 946 CDS 100% 4.050 2.835 N Serpinb2 n/a
10 TRCN0000080313 GCAGTTATGGTATCACCACAA pLKO.1 382 CDS 100% 4.050 2.835 N Serpinb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.