Transcript: Mouse XM_011247986.2

PREDICTED: Mus musculus G protein-coupled receptor 55 (Gpr55), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr55 (227326)
Length:
2497
CDS:
256..1323

Additional Resources:

NCBI RefSeq record:
XM_011247986.2
NBCI Gene record:
Gpr55 (227326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238559 TCTGGTGAGGAACCGCTTTAT pLKO_005 1113 CDS 100% 13.200 9.240 N Gpr55 n/a
2 TRCN0000238560 TTCTGTTCCTATAGGAGTATT pLKO_005 931 CDS 100% 13.200 9.240 N Gpr55 n/a
3 TRCN0000238556 CTTGCAGCTGGCAGTCCATAT pLKO_005 399 CDS 100% 10.800 7.560 N Gpr55 n/a
4 TRCN0000238558 TCATTCGATTCCGTGGATAAG pLKO_005 367 CDS 100% 10.800 7.560 N Gpr55 n/a
5 TRCN0000011614 TGCTACTACTTTGTCATCAAA pLKO.1 1222 CDS 100% 5.625 3.938 N GPR55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.