Transcript: Mouse XM_011248066.2

PREDICTED: Mus musculus calmodulin regulated spectrin-associated protein family, member 2 (Camsap2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camsap2 (67886)
Length:
5908
CDS:
80..3319

Additional Resources:

NCBI RefSeq record:
XM_011248066.2
NBCI Gene record:
Camsap2 (67886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252417 ACGGTTCTTACTAGGTGATAA pLKO_005 3487 3UTR 100% 13.200 18.480 N Camsap2 n/a
2 TRCN0000252415 ATGGCGTTTCATTCGACATTT pLKO_005 138 CDS 100% 13.200 18.480 N Camsap2 n/a
3 TRCN0000252419 AGTTTCTCTGTCCGATTTAAA pLKO_005 2197 CDS 100% 15.000 10.500 N Camsap2 n/a
4 TRCN0000166929 CCAGGATATGTAACTCTTATA pLKO.1 4921 3UTR 100% 13.200 9.240 N CAMSAP2 n/a
5 TRCN0000369318 GACATGGATGATGCATCTAAA pLKO_005 776 CDS 100% 13.200 10.560 N CAMSAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.