Transcript: Mouse XM_011248087.2

PREDICTED: Mus musculus transmembrane protein 163 (Tmem163), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem163 (72160)
Length:
2192
CDS:
391..1284

Additional Resources:

NCBI RefSeq record:
XM_011248087.2
NBCI Gene record:
Tmem163 (72160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179473 GCCCTCAGTTTATGTAACATT pLKO.1 2070 3UTR 100% 5.625 4.500 N Tmem163 n/a
2 TRCN0000179775 GACGCGTCATTATGAAATGTT pLKO.1 1257 CDS 100% 5.625 3.938 N Tmem163 n/a
3 TRCN0000172457 CCATCCATGACCTCTCAACTA pLKO.1 932 CDS 100% 4.950 3.465 N TMEM163 n/a
4 TRCN0000184069 CCATTCTAAGCGGGATCCTTT pLKO.1 992 CDS 100% 4.950 3.465 N Tmem163 n/a
5 TRCN0000184280 GCTGTCCATTATTGTCACCCT pLKO.1 693 CDS 100% 0.660 0.462 N Tmem163 n/a
6 TRCN0000181037 CCTTCTAAGTGCAGAAGTGTT pLKO.1 1122 CDS 100% 0.495 0.347 N Tmem163 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248087.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.