Transcript: Mouse XM_011248195.2

PREDICTED: Mus musculus myosin 1H (Myo1h), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo1h (231646)
Length:
4530
CDS:
475..3591

Additional Resources:

NCBI RefSeq record:
XM_011248195.2
NBCI Gene record:
Myo1h (231646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366478 TCGAGCGGCTGATCAAGTATA pLKO_005 2483 CDS 100% 13.200 18.480 N Myo1h n/a
2 TRCN0000379137 AGGCGCAAGTACGAGCATTTC pLKO_005 2395 CDS 100% 10.800 15.120 N Myo1h n/a
3 TRCN0000100509 CAAGTATGACAGGAAGGGCTT pLKO.1 3180 CDS 100% 2.160 1.728 N Myo1h n/a
4 TRCN0000100507 CTGGATGAAAGCAACATAAAT pLKO.1 3103 CDS 100% 15.000 10.500 N Myo1h n/a
5 TRCN0000375224 CCCTGGTGGAACCCAATTTAG pLKO_005 3806 3UTR 100% 13.200 9.240 N Myo1h n/a
6 TRCN0000100505 CGTGAGTAGAAGCAGAGTTTA pLKO.1 4143 3UTR 100% 13.200 9.240 N Myo1h n/a
7 TRCN0000366412 TCCGAGAGAACCTCATCTATA pLKO_005 629 CDS 100% 13.200 9.240 N Myo1h n/a
8 TRCN0000100508 GAGAGCTTGAACCAACTGTTT pLKO.1 3070 CDS 100% 4.950 3.465 N Myo1h n/a
9 TRCN0000100506 GAAAGCAACATAAATCCCAAA pLKO.1 3109 CDS 100% 4.050 2.835 N Myo1h n/a
10 TRCN0000366411 AGAGGAAGACCAAGTCTATAA pLKO_005 3522 CDS 100% 13.200 7.920 N Myo1h n/a
11 TRCN0000375223 TGCCAGCCAGATGGAACTTTA pLKO_005 708 CDS 100% 13.200 7.920 N Myo1h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.