Transcript: Mouse XM_011248239.2

PREDICTED: Mus musculus serine/arginine repetitive matrix 4 (Srrm4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srrm4 (68955)
Length:
7906
CDS:
882..2606

Additional Resources:

NCBI RefSeq record:
XM_011248239.2
NBCI Gene record:
Srrm4 (68955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200588 CCCAATCAAATTAGGGAAATA pLKO.1 3733 3UTR 100% 13.200 18.480 N Srrm4 n/a
2 TRCN0000201831 GTATGGTGAGAAAGAACCACA pLKO.1 2180 CDS 100% 2.640 1.848 N Srrm4 n/a
3 TRCN0000191638 GTCAAGAAGAAGAAGAAGAAA pLKO.1 1170 CDS 100% 5.625 2.813 Y Srrm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.