Transcript: Mouse XM_011248240.3

PREDICTED: Mus musculus zinc finger, CCHC domain containing 8 (Zcchc8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zcchc8 (70650)
Length:
2322
CDS:
272..1741

Additional Resources:

NCBI RefSeq record:
XM_011248240.3
NBCI Gene record:
Zcchc8 (70650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229802 GATTCAAGCCAGGAGTTATTA pLKO_005 474 CDS 100% 15.000 12.000 N ZCCHC8 n/a
2 TRCN0000123779 CCTTTCAGAATCTGGTGTAAT pLKO.1 1817 3UTR 100% 13.200 10.560 N Zcchc8 n/a
3 TRCN0000309639 CCTTTCAGAATCTGGTGTAAT pLKO_005 1817 3UTR 100% 13.200 10.560 N Zcchc8 n/a
4 TRCN0000123781 CGGTGTGTTGAACATGAACAT pLKO.1 1501 CDS 100% 4.950 3.960 N Zcchc8 n/a
5 TRCN0000309638 CGGTGTGTTGAACATGAACAT pLKO_005 1501 CDS 100% 4.950 3.960 N Zcchc8 n/a
6 TRCN0000123783 TGTCAACAGAAGGATGTGTTT pLKO.1 794 CDS 100% 4.950 3.465 N Zcchc8 n/a
7 TRCN0000309637 TGTCAACAGAAGGATGTGTTT pLKO_005 794 CDS 100% 4.950 3.465 N Zcchc8 n/a
8 TRCN0000075162 CCAGGAGTTATTAGTGAGGAA pLKO.1 482 CDS 100% 2.640 1.848 N ZCCHC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.