Transcript: Mouse XM_011248299.1

PREDICTED: Mus musculus breast cancer anti-estrogen resistance 1 (Bcar1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcar1 (12927)
Length:
3169
CDS:
962..2761

Additional Resources:

NCBI RefSeq record:
XM_011248299.1
NBCI Gene record:
Bcar1 (12927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109523 CGTGAGGAAACCTATGATGTA pLKO.1 1115 CDS 100% 4.950 6.930 N Bcar1 n/a
2 TRCN0000109521 CGGTGTATGATGTTCCTCCTT pLKO.1 1059 CDS 100% 2.640 3.696 N Bcar1 n/a
3 TRCN0000109524 GCGTGAGGAAACCTATGATGT pLKO.1 1114 CDS 100% 4.950 3.960 N Bcar1 n/a
4 TRCN0000334145 GCGTGAGGAAACCTATGATGT pLKO_005 1114 CDS 100% 4.950 3.960 N Bcar1 n/a
5 TRCN0000348135 ACCAACCACCCAAGATCTTTG pLKO_005 2463 CDS 100% 10.800 7.560 N Bcar1 n/a
6 TRCN0000109520 CCAGCATTCATTCCTCTTGAA pLKO.1 2815 3UTR 100% 4.950 3.465 N Bcar1 n/a
7 TRCN0000334146 CCAGCATTCATTCCTCTTGAA pLKO_005 2815 3UTR 100% 4.950 3.465 N Bcar1 n/a
8 TRCN0000436978 GGATGGAGGACTATGACTACG pLKO_005 2127 CDS 100% 4.050 2.835 N BCAR1 n/a
9 TRCN0000109522 CCTCAAGATTCTGGTTGGCAT pLKO.1 215 5UTR 100% 2.640 1.584 N Bcar1 n/a
10 TRCN0000334144 CCTCAAGATTCTGGTTGGCAT pLKO_005 215 5UTR 100% 2.640 1.584 N Bcar1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.