Transcript: Mouse XM_011248379.2

PREDICTED: Mus musculus TOX high mobility group box family member 3 (Tox3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tox3 (244579)
Length:
4647
CDS:
1807..3483

Additional Resources:

NCBI RefSeq record:
XM_011248379.2
NBCI Gene record:
Tox3 (244579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413123 GTGTTACCGCAGGTCAGTATT pLKO_005 3457 CDS 100% 13.200 18.480 N Tox3 n/a
2 TRCN0000426734 TGTCTATTAGATAGGCAATAA pLKO_005 3600 3UTR 100% 13.200 18.480 N Tox3 n/a
3 TRCN0000081814 GAGGCAAACAACGCCTTCTTT pLKO.1 1873 CDS 100% 5.625 4.500 N Tox3 n/a
4 TRCN0000237900 CCAACATGCCCTCGAACATTG pLKO_005 2966 CDS 100% 10.800 7.560 N TOX3 n/a
5 TRCN0000081817 AGGAATCTGGTGGAGCAAGAT pLKO.1 2110 CDS 100% 4.950 3.465 N Tox3 n/a
6 TRCN0000081813 GCCCATTATGTTCATTCCAAT pLKO.1 4176 3UTR 100% 4.950 3.465 N Tox3 n/a
7 TRCN0000081815 CAGGCTGCAATTAAGGGTCAA pLKO.1 2560 CDS 100% 4.050 2.835 N Tox3 n/a
8 TRCN0000081816 CTTAACCATGAGACTACCCAT pLKO.1 2913 CDS 100% 2.640 1.848 N Tox3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248379.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.