Transcript: Mouse XM_011248395.2

PREDICTED: Mus musculus pecanex homolog 2 (Pcnx2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcnx2 (270109)
Length:
7113
CDS:
89..6478

Additional Resources:

NCBI RefSeq record:
XM_011248395.2
NBCI Gene record:
Pcnx2 (270109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193358 CTATAGCATCATCGATAACAA pLKO.1 4576 CDS 100% 5.625 7.875 N Pcnx2 n/a
2 TRCN0000176209 GCATGGATAATTCCAACACAA pLKO.1 4137 CDS 100% 4.950 6.930 N Pcnx2 n/a
3 TRCN0000173946 GCCAGTTACCACAGAACTCTT pLKO.1 736 CDS 100% 4.950 6.930 N Pcnx2 n/a
4 TRCN0000175416 CAGGGACCACTTAATAGTATT pLKO.1 2899 CDS 100% 13.200 10.560 N Pcnx2 n/a
5 TRCN0000175190 CGAACCCATTAAGATAGTAAT pLKO.1 1183 CDS 100% 13.200 10.560 N Pcnx2 n/a
6 TRCN0000173370 GTTCTGGGAGAGAAGCTATAA pLKO.1 4108 CDS 100% 13.200 9.240 N Pcnx2 n/a
7 TRCN0000175415 CAGACCCATCTATTTCTGTAT pLKO.1 2770 CDS 100% 4.950 3.465 N Pcnx2 n/a
8 TRCN0000173223 CAAGAATGAATCCCTGCTGAA pLKO.1 4705 CDS 100% 4.050 2.835 N Pcnx2 n/a
9 TRCN0000175804 GCTGGTTAAATTAGAACAGCT pLKO.1 6757 3UTR 100% 2.640 1.848 N Pcnx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.