Transcript: Mouse XM_011248453.1

PREDICTED: Mus musculus polyamine modulated factor 1 binding protein 1 (Pmfbp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pmfbp1 (56523)
Length:
4464
CDS:
1069..4227

Additional Resources:

NCBI RefSeq record:
XM_011248453.1
NBCI Gene record:
Pmfbp1 (56523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182574 GCTTTGCGACAAGAAGCGAAA pLKO.1 3121 CDS 100% 4.050 5.670 N Pmfbp1 n/a
2 TRCN0000182231 CCGGGTCAATAAGCAATACCA pLKO.1 1416 CDS 100% 3.000 4.200 N Pmfbp1 n/a
3 TRCN0000198992 GAAGATGAAATCGCGGCTTAT pLKO.1 3535 CDS 100% 10.800 7.560 N Pmfbp1 n/a
4 TRCN0000197573 CATGGTTAGTAAAGAAGCTTA pLKO.1 3378 CDS 100% 4.950 3.465 N Pmfbp1 n/a
5 TRCN0000200444 GAGCCTACAACTGGACATCAA pLKO.1 1257 CDS 100% 4.950 3.465 N Pmfbp1 n/a
6 TRCN0000197715 GTTTGCAAGAAGTTATGCTTT pLKO.1 4343 3UTR 100% 4.950 3.465 N Pmfbp1 n/a
7 TRCN0000182846 CGTCATCGAGAAGAAGGACAA pLKO.1 2298 CDS 100% 4.050 2.835 N Pmfbp1 n/a
8 TRCN0000198991 GACATCAAGAATCTCCACGAT pLKO.1 1270 CDS 100% 2.640 1.848 N Pmfbp1 n/a
9 TRCN0000181560 GCAGAAGATTGCCAATGAGAA pLKO.1 3894 CDS 100% 4.950 2.970 N Pmfbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.