Transcript: Mouse XM_011248469.2

PREDICTED: Mus musculus zinc finger protein 827 (Zfp827), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp827 (622675)
Length:
8229
CDS:
856..4947

Additional Resources:

NCBI RefSeq record:
XM_011248469.2
NBCI Gene record:
Zfp827 (622675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225887 ATGTGCCATTTGGCTAATAAT pLKO_005 7265 3UTR 100% 15.000 21.000 N Zfp827 n/a
2 TRCN0000255316 GACCCACCTAGTTCCAATAAA pLKO_005 1444 CDS 100% 15.000 21.000 N Zfp827 n/a
3 TRCN0000225884 GGTGATTCACACGGGCTTAAA pLKO_005 2280 CDS 100% 13.200 18.480 N Zfp827 n/a
4 TRCN0000255318 GATTGTTCATCGACGACTTTC pLKO_005 5539 3UTR 100% 10.800 15.120 N Zfp827 n/a
5 TRCN0000143146 CAACTTTGTCTGCAAGACGAA pLKO.1 3957 CDS 100% 2.640 3.696 N ZNF827 n/a
6 TRCN0000225885 CTCGCAAGGACAATCTCAAAT pLKO_005 2336 CDS 100% 13.200 9.240 N Zfp827 n/a
7 TRCN0000230682 CTCGCAAGGACAATCTCAAAT pLKO_005 2336 CDS 100% 13.200 9.240 N ZNF827 n/a
8 TRCN0000255315 TGGGAAGAAACACCCGTATTA pLKO_005 3552 CDS 100% 13.200 9.240 N Zfp827 n/a
9 TRCN0000219088 TTGTCTGCAAGACGAAGAATA pLKO_005 3962 CDS 100% 13.200 9.240 N Zfp827 n/a
10 TRCN0000255317 ACCTCATCACCCGGATGTTTG pLKO_005 4007 CDS 100% 10.800 7.560 N Zfp827 n/a
11 TRCN0000267555 GGTTAAGATGGCCTCCGATTT pLKO_005 2811 CDS 100% 10.800 7.560 N Zfp827 n/a
12 TRCN0000225886 TATCACCCAGCCGGAACATTG pLKO_005 2930 CDS 100% 10.800 7.560 N Zfp827 n/a
13 TRCN0000140808 GTTCAAGACCACACACCCTTT pLKO.1 4479 CDS 100% 4.050 2.430 N ZNF827 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 811 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.