Transcript: Mouse XM_011248481.2

PREDICTED: Mus musculus beta-carotene oxygenase 1 (Bco1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Bco1 (63857)
Length:
3496
CDS:
181..1761

Additional Resources:

NCBI RefSeq record:
XM_011248481.2
NBCI Gene record:
Bco1 (63857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076325 CCAACCAAGATACTGAAATAT pLKO.1 1474 CDS 100% 15.000 12.000 N Bco1 n/a
2 TRCN0000076324 CCCTCGGATAAATTATGCTTA pLKO.1 1398 CDS 100% 4.950 3.465 N Bco1 n/a
3 TRCN0000076326 GAGACCAACTACATCAGGAAA pLKO.1 598 CDS 100% 4.950 3.465 N Bco1 n/a
4 TRCN0000076327 GAAGCCATATCGCTACATCTT pLKO.1 1425 CDS 100% 4.950 2.970 N Bco1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.