Transcript: Mouse XM_011248524.1

PREDICTED: Mus musculus cylindromatosis (turban tumor syndrome) (Cyld), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyld (74256)
Length:
8168
CDS:
369..3236

Additional Resources:

NCBI RefSeq record:
XM_011248524.1
NBCI Gene record:
Cyld (74256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362571 TGTTACTTAGACTCAACTTTA pLKO_005 2166 CDS 100% 13.200 18.480 N Cyld n/a
2 TRCN0000030990 GCCCAATACTAATGGCAGCAT pLKO.1 1643 CDS 100% 2.640 3.696 N Cyld n/a
3 TRCN0000030989 GCAGCCTGTTTCCAATCAAAT pLKO.1 2009 CDS 100% 13.200 10.560 N Cyld n/a
4 TRCN0000362562 AGACTGTAACTTCTATCAAAT pLKO_005 2495 CDS 100% 13.200 9.240 N Cyld n/a
5 TRCN0000030993 CCCTGGACACTGTGTTACTTA pLKO.1 2212 CDS 100% 5.625 3.938 N Cyld n/a
6 TRCN0000030991 GCAGTTATTAGAATGGTCTTT pLKO.1 2558 CDS 100% 4.950 3.465 N Cyld n/a
7 TRCN0000030992 GCATTGGACAAACTAGAACTT pLKO.1 960 CDS 100% 4.950 3.465 N Cyld n/a
8 TRCN0000018366 GAAGAAGGTCGTGGTCAAGGT pLKO.1 873 CDS 100% 2.640 1.848 N CYLD n/a
9 TRCN0000362561 AGGAGAGGCTCAGCCTATTTA pLKO_005 688 CDS 100% 15.000 9.000 N Cyld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.