Transcript: Mouse XM_011248596.2

PREDICTED: Mus musculus pecanex homolog 3 (Pcnx3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcnx3 (104401)
Length:
6956
CDS:
482..6538

Additional Resources:

NCBI RefSeq record:
XM_011248596.2
NBCI Gene record:
Pcnx3 (104401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249378 GACCTCTGCCGATCGAGAAAT pLKO_005 1009 CDS 100% 13.200 18.480 N Pcnx3 n/a
2 TRCN0000249375 TGGTCTCTAGTCCGGAGTAAA pLKO_005 3479 CDS 100% 13.200 18.480 N Pcnx3 n/a
3 TRCN0000194014 GTTCACCTTATGCTTTCCGTT pLKO.1 3169 CDS 100% 2.640 3.696 N Pcnx3 n/a
4 TRCN0000249376 GTTCTGGGCTTCGTGTTATAT pLKO_005 3683 CDS 100% 15.000 10.500 N Pcnx3 n/a
5 TRCN0000217075 CACTCCGCAACATGATCAATT pLKO.1 5742 CDS 100% 13.200 9.240 N Pcnx3 n/a
6 TRCN0000249377 CACTCCGCAACATGATCAATT pLKO_005 5742 CDS 100% 13.200 9.240 N Pcnx3 n/a
7 TRCN0000253851 TGAGGGTGCTGTGCACTATTT pLKO_005 2455 CDS 100% 13.200 9.240 N PCNX3 n/a
8 TRCN0000216671 CTTCCGAGTCATCAAGGTAAA pLKO.1 5620 CDS 100% 10.800 7.560 N Pcnx3 n/a
9 TRCN0000249374 ACAACTCAGTGACCTAGACTT pLKO_005 6662 3UTR 100% 4.950 3.465 N Pcnx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.