Transcript: Mouse XM_011248795.1

PREDICTED: Mus musculus phospholipase D2 (Pld2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pld2 (18806)
Length:
3687
CDS:
438..3140

Additional Resources:

NCBI RefSeq record:
XM_011248795.1
NBCI Gene record:
Pld2 (18806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076936 CATGTCTTTCTATCGCAATTA pLKO.1 962 CDS 100% 13.200 18.480 N Pld2 n/a
2 TRCN0000332506 CATGTCTTTCTATCGCAATTA pLKO_005 962 CDS 100% 13.200 18.480 N Pld2 n/a
3 TRCN0000222625 GCAGTGTTTCCGAGTCTACTT pLKO.1 2354 CDS 100% 4.950 3.960 N Pld2 n/a
4 TRCN0000332434 GCAGTGTTTCCGAGTCTACTT pLKO_005 2354 CDS 100% 4.950 3.960 N Pld2 n/a
5 TRCN0000311510 TGGGAACCTGTACTCTATATT pLKO_005 679 CDS 100% 15.000 10.500 N Pld2 n/a
6 TRCN0000306297 ACCACCAAGGCCAGGTATAAG pLKO_005 2040 CDS 100% 13.200 9.240 N Pld2 n/a
7 TRCN0000076933 CCTTCCTGTCACCAAGTTCAA pLKO.1 3361 3UTR 100% 4.950 3.465 N Pld2 n/a
8 TRCN0000332508 CCTTCCTGTCACCAAGTTCAA pLKO_005 3361 3UTR 100% 4.950 3.465 N Pld2 n/a
9 TRCN0000051152 CGATGAGATTGTGGACAGAAT pLKO.1 2312 CDS 100% 4.950 3.465 N PLD2 n/a
10 TRCN0000076935 GCAAACAGAAATACTTGGAAA pLKO.1 919 CDS 100% 4.950 3.465 N Pld2 n/a
11 TRCN0000222624 CCAATTCTTCTGGCTGGGAAA pLKO.1 1844 CDS 100% 4.050 2.835 N Pld2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.